Python endpoints#

The variant-mapper package installs several Python command-line endpoints. Some are part of the key functionality of the package, others are more tangential and involved in the generation of the mapping files, the end user does not really need these but they are documented for completeness/my reference.

Core scripts#

These are the scripts that can be used ofr mapping the variants on the command line. Example usage can be seen in the TLDR; . The full help for these is given below.

variant-mapper-tabix#

map/annotate genetic variants. This uses tabix to localise the variant positions

usage: variant-mapper-tabix [-h] [-i INFILE] [-o OUTFILE]
                            [--ref-assembly REF_ASSEMBLY] [-T TMP_DIR] [-v]
                            [-d DELIMITER] [-c COMMENT_CHAR] [-C CHR_NAME]
                            [-P CHR_POS_SPEC] [-S START_POS] [-F STRAND]
                            [-A ALT_ALLELE] [-R REF_ALLELE] [-V VAR_ID]
                            [-D DEBUG] [--decode-map-info]
                            [-p POPS [POPS ...]] [-w WEIGHTS [WEIGHTS ...]]
                            [-m {hierarchy,mean}] [--list-pops]
                            mapping_file

Positional Arguments#

mapping_file

The mapping VCF file

Named Arguments#

-i, --infile

An input file, if not provided then STDIN is used

-o, --outfile

An output file, if not provided then STDOUT is used

--ref-assembly

A reference assembly to use to normalise INDELs

-T, --tmp-dir

An alternative location for tmp files and directories. Thisdefaults to what every the system tmp location is (usually /tmp)

-v, --verbose

Give progress updates

Default: False

-d, --delimiter

An input file delimiter (default=’t’)

Default: '    '

-c, --comment-char

The comment character, lines starting with this are ignored (but still output) (default: ##)

Default: '##'

-C, --chr-name

The name of the chromosome column, or if –chr-pos-spec isdefined, then the chromosome-position column (default: #CHROM)

Default: '#CHROM'

-P, --chr-pos-spec

The format of the chromosome position column, if the file has one. In this case the column name defined in the –chr-name argument is treated as a chromosome-position column. This should be a string formatted like ‘^CHR_NAME|START_POS$’

-S, --start-pos

The name of the start position column (default: POS)

-F, --strand

The name of the strand column, if not provided it is assumed that the strand is 1

-A, --alt-allele

The name of the alternate allele column (if present), if not if this is defined then the end position is calculated from the start position + length(ref) - 1

-R, --ref-allele

The name of the reference allele column (if present), if not if this is defined then the end position is calculated from the start position + length(ref) - 1

-V, --var-id

The name of any existing variant identifier columns (if present)

-D, --debug

Only run for –debug number of rows, this allows for smaller scale tests on the inpt files will eventually be removed

--decode-map-info

Decode the mapping info bits

Default: False

-p, --pops

The populations to use in the mapping file if > 1 –pops argument then method must be ‘hierarchy’

Default: []

-w, --weights

The weights to apply to the population, if not provided then even weights assumed. The number of weights provided must equal the number of –pops arguments if –method is ‘hierarchy’. If –method is ‘mean’ then the number of weights must equal the number of arguments supplied to –pops

Default: []

-m, --aaf-method

Possible choices: hierarchy, mean

The method to use for calculating the reference allele frequency

Default: 'mean'

--list-pops

List all the available populations and exit

Default: False

variant-mapper-scan#

map/annotate genetic variants. This uses join-scans localise the variant positions

usage: variant-mapper-scan [-h] [-i INFILE] [-o OUTFILE]
                           [--ref-assembly REF_ASSEMBLY] [-T TMP_DIR] [-v]
                           [-d DELIMITER] [-c COMMENT_CHAR] [-C CHR_NAME]
                           [-P CHR_POS_SPEC] [-S START_POS] [-F STRAND]
                           [-A ALT_ALLELE] [-R REF_ALLELE] [-V VAR_ID]
                           [-D DEBUG] [--decode-map-info] [-p POPS [POPS ...]]
                           [-w WEIGHTS [WEIGHTS ...]] [-m {hierarchy,mean}]
                           [--list-pops] [-I TABIX]
                           mapping_file

Positional Arguments#

mapping_file

The mapping VCF file

Named Arguments#

-i, --infile

An input file, if not provided then STDIN is used If pre-sorted on chr_name (str), start_pos (int), then use –no-sort to prevent internal sorting

-o, --outfile

An output file, if not provided then STDOUT is used

--ref-assembly

A reference assembly to use to normalise INDELs

-T, --tmp-dir

An alternative location for tmp files and directories. Thisdefaults to what every the system tmp location is (usually /tmp)

-v, --verbose

Give progress updates

Default: False

-d, --delimiter

An input file delimiter (default=’t’)

Default: '    '

-c, --comment-char

The comment character, lines starting with this are ignored (but still output) (default: ##)

Default: '##'

-C, --chr-name

The name of the chromosome column, or if –chr-pos-spec isdefined, then the chromosome-position column (default: #CHROM)

Default: '#CHROM'

-P, --chr-pos-spec

The format of the chromosome position column, if the file has one. In this case the column name defined in the –chr-name argument is treated as a chromosome-position column. This should be a string formatted like ‘^CHR_NAME|START_POS$’

-S, --start-pos

The name of the start position column (default: POS)

-F, --strand

The name of the strand column, if not provided it is assumed that the strand is 1

-A, --alt-allele

The name of the alternate allele column (if present), if not if this is defined then the end position is calculated from the start position + length(ref) - 1

-R, --ref-allele

The name of the reference allele column (if present), if not if this is defined then the end position is calculated from the start position + length(ref) - 1

-V, --var-id

The name of any existing variant identifier columns (if present)

-D, --debug

Only run for –debug number of rows, this allows for smaller scale tests on the inpt files will eventually be removed

--decode-map-info

Decode the mapping info bits

Default: False

-p, --pops

The populations to use in the mapping file if > 1 –pops argument then method must be ‘hierarchy’

Default: []

-w, --weights

The weights to apply to the population, if not provided then even weights assumed. The number of weights provided must equal the number of –pops arguments if –method is ‘hierarchy’. If –method is ‘mean’ then the number of weights must equal the number of arguments supplied to –pops

Default: []

-m, --aaf-method

Possible choices: hierarchy, mean

The method to use for calculating the reference allele frequency

Default: 'mean'

--list-pops

List all the available populations and exit

Default: False

-I, --tabix

Use an additional index mapping files when scan mapping.

variant-mapper-ensembl#

map/annotate genetic variants. This uses ensembl-rest-API to localise the variant positions

usage: variant-mapper-ensembl [-h] [--rest-url REST_URL] [-i INFILE]
                              [-o OUTFILE] [--ref-assembly REF_ASSEMBLY]
                              [-T TMP_DIR] [-v] [-d DELIMITER]
                              [-c COMMENT_CHAR] [-C CHR_NAME]
                              [-P CHR_POS_SPEC] [-S START_POS] [-F STRAND]
                              [-A ALT_ALLELE] [-R REF_ALLELE] [-V VAR_ID]
                              [-D DEBUG] [--decode-map-info]
                              [-p POPS [POPS ...]] [-w WEIGHTS [WEIGHTS ...]]
                              [-m {hierarchy,mean}] [--list-pops]

Named Arguments#

--rest-url

The URL to use for Ensembl REST access (defaults to GRCh38)

Default: 'https://rest.ensembl.org'

-i, --infile

An input file, if not provided then STDIN is used

-o, --outfile

An output file, if not provided then STDOUT is used

--ref-assembly

A reference assembly to use to normalise INDELs. If not provided will use REST to query the genome

-T, --tmp-dir

An alternative location for tmp files and directories. Thisdefaults to what every the system tmp location is (usually /tmp)

-v, --verbose

Give progress updates

Default: False

-d, --delimiter

An input file delimiter (default=’t’)

Default: '    '

-c, --comment-char

The comment character, lines starting with this are ignored (but still output) (default: ##)

Default: '##'

-C, --chr-name

The name of the chromosome column, or if –chr-pos-spec isdefined, then the chromosome-position column (default: #CHROM)

Default: '#CHROM'

-P, --chr-pos-spec

The format of the chromosome position column, if the file has one. In this case the column name defined in the –chr-name argument is treated as a chromosome-position column. This should be a string formatted like ‘^CHR_NAME|START_POS$’

-S, --start-pos

The name of the start position column (default: POS)

-F, --strand

The name of the strand column, if not provided it is assumed that the strand is 1

-A, --alt-allele

The name of the alternate allele column (if present), if not if this is defined then the end position is calculated from the start position + length(ref) - 1

-R, --ref-allele

The name of the reference allele column (if present), if not if this is defined then the end position is calculated from the start position + length(ref) - 1

-V, --var-id

The name of any existing variant identifier columns (if present)

-D, --debug

Only run for –debug number of rows, this allows for smaller scale tests on the inpt files will eventually be removed

--decode-map-info

Decode the mapping info bits

Default: False

-p, --pops

The populations to use in the mapping file if > 1 –pops argument then method must be ‘hierarchy’

Default: []

-w, --weights

The weights to apply to the population, if not provided then even weights assumed. The number of weights provided must equal the number of –pops arguments if –method is ‘hierarchy’. If –method is ‘mean’ then the number of weights must equal the number of arguments supplied to –pops

Default: []

-m, --aaf-method

Possible choices: hierarchy, mean

The method to use for calculating the reference allele frequency

Default: 'mean'

--list-pops

List all the available populations and exit

Default: False

Mapping file generation#

dbsnp-download#

Download dbSNP JSON files and simultaneously process into gzip chunk files with a max number or rows per file. This enables easier parallel processing downstream.

The chunking process can take a while, however, multiple processes can be assigned to it, although, each process can only tackle a single file. In future, I will leverage the bgzip2 format to define chunk positions within the files.

usage: dbsnp-download [-h] [--url URL] [-T TMP] [-u CHUNK_SIZE] [-p PROCESSES]
                      [-v]
                      outdir download_dir

Positional Arguments#

outdir

The output directory for processed chunk files.

download_dir

The directory for downloaded files.

Named Arguments#

--url

The location of tmp, if not provided will use the system tmp

Default: 'ftp.ncbi.nlm.nih.gov'

-T, --tmp

The location of tmp, if not provided will use the system tmp

-u, --chunk-size

The max number of JSON rows to output into each file.

Default: 1000000

-p, --processes

The max number of processes to use for chunking files.

Default: 1

-v, --verbose

Log output to STDERR, use -v to display file count progress and -vv for download progress monitor

format-dbsnp#

Reformat the dbSNP VCF to regular chromosome names.

usage: format-dbsnp [-h] [-v] [-c] infile assembly [outfile]

Positional Arguments#

infile

A required file

assembly

An assembly chromosome mapper

outfile

An optional output file, if not provided output is to STDOUT

Named Arguments#

-v, --verbose

give more output

Default: False

-c, --ignore-chr-version

Ignore the chromosome version i.e. .11

Default: False

Input VCF#

Below is an example of the input dbSNP VCF

##fileformat=VCFv4.2
##fileDate=20200501
##source=dbSNP
##dbSNP_BUILD_ID=154
##reference=GRCh38.p12
##phasing=partial
##INFO=<ID=RS,Number=1,Type=Integer,Description="dbSNP ID (i.e. rs number)">
##INFO=<ID=GENEINFO,Number=1,Type=String,Description="Pairs each of gene symbol:gene id.  The gene symbol and id are delimited by a colon (:) and each pair is delimite
##INFO=<ID=PSEUDOGENEINFO,Number=1,Type=String,Description="Pairs each of pseudogene symbol:gene id.  The pseudogene symbol and id are delimited by a colon (:) and eac
##INFO=<ID=dbSNPBuildID,Number=1,Type=Integer,Description="First dbSNP Build for RS">
##INFO=<ID=SAO,Number=1,Type=Integer,Description="Variant Allele Origin: 0 - unspecified, 1 - Germline, 2 - Somatic, 3 - Both">
##INFO=<ID=SSR,Number=1,Type=Integer,Description="Variant Suspect Reason Codes (may be more than one value added together) 0 - unspecified, 1 - Paralog, 2 - byEST, 4 -
##INFO=<ID=VC,Number=1,Type=String,Description="Variation Class">
##INFO=<ID=PM,Number=0,Type=Flag,Description="Variant has associated publication">
##INFO=<ID=NSF,Number=0,Type=Flag,Description="Has non-synonymous frameshift A coding region variation where one allele in the set changes all downstream amino acids.
##INFO=<ID=NSM,Number=0,Type=Flag,Description="Has non-synonymous missense A coding region variation where one allele in the set changes protein peptide. FxnClass = 42
##INFO=<ID=NSN,Number=0,Type=Flag,Description="Has non-synonymous nonsense A coding region variation where one allele in the set changes to STOP codon (TER). FxnClass
##INFO=<ID=SYN,Number=0,Type=Flag,Description="Has synonymous A coding region variation where one allele in the set does not change the encoded amino acid. FxnCode = 3
##INFO=<ID=U3,Number=0,Type=Flag,Description="In 3' UTR Location is in an untranslated region (UTR). FxnCode = 53">
##INFO=<ID=U5,Number=0,Type=Flag,Description="In 5' UTR Location is in an untranslated region (UTR). FxnCode = 55">
##INFO=<ID=ASS,Number=0,Type=Flag,Description="In acceptor splice site FxnCode = 73">
##INFO=<ID=DSS,Number=0,Type=Flag,Description="In donor splice-site FxnCode = 75">
##INFO=<ID=INT,Number=0,Type=Flag,Description="In Intron FxnCode = 6">
##INFO=<ID=R3,Number=0,Type=Flag,Description="In 3' gene region FxnCode = 13">
##INFO=<ID=R5,Number=0,Type=Flag,Description="In 5' gene region FxnCode = 15">
##INFO=<ID=GNO,Number=0,Type=Flag,Description="Genotypes available.">
##INFO=<ID=PUB,Number=0,Type=Flag,Description="RefSNP or associated SubSNP is mentioned in a publication">
##INFO=<ID=FREQ,Number=.,Type=String,Description="An ordered list of allele frequencies as reported by various genomic studies, starting with the reference allele foll
##INFO=<ID=COMMON,Number=0,Type=Flag,Description="RS is a common SNP.  A common SNP is one that has at least one 1000Genomes population with a minor allele of frequenc
##INFO=<ID=CLNHGVS,Number=.,Type=String,Description="Variant names from HGVS.    The order of these variants corresponds to the order of the info in the other clinical
##INFO=<ID=CLNVI,Number=.,Type=String,Description="Variant Identifiers provided and maintained by organizations outside of NCBI, such as OMIM.  Source and id separated
##INFO=<ID=CLNORIGIN,Number=.,Type=String,Description="Allele Origin. One or more of the following values may be summed: 0 - unknown; 1 - germline; 2 - somatic; 4 - in
##INFO=<ID=CLNSIG,Number=.,Type=String,Description="Variant Clinical Significance, 0 - Uncertain significance, 1 - not provided, 2 - Benign, 3 - Likely benign, 4 - Lik
##INFO=<ID=CLNDISDB,Number=.,Type=String,Description="Variant disease database name and ID, separated by colon (:)">
##INFO=<ID=CLNDN,Number=.,Type=String,Description="Preferred ClinVar disease name">
##INFO=<ID=CLNREVSTAT,Number=.,Type=String,Description="ClinVar Review Status: no_assertion - No asserition provided by submitter, no_criteria - No assertion criteria
##INFO=<ID=CLNACC,Number=.,Type=String,Description="For each allele (comma delimited), this is a pipe-delimited list of the Clinvar RCV phenotype accession.version str
#CHROM  POS     ID      REF     ALT     QUAL    FILTER  INFO
NC_000001.11    10001   rs1570391677    T       A       .       .       RS=1570391677;dbSNPBuildID=154;SSR=0;PSEUDOGENEINFO=DDX11L1:100287102;VC=SNV;GNO;FREQ=KOREAN:0.
NC_000001.11    10002   rs1570391692    A       C       .       .       RS=1570391692;dbSNPBuildID=154;SSR=0;PSEUDOGENEINFO=DDX11L1:100287102;VC=SNV;GNO;FREQ=KOREAN:0.
NC_000001.11    10003   rs1570391694    A       C       .       .       RS=1570391694;dbSNPBuildID=154;SSR=0;PSEUDOGENEINFO=DDX11L1:100287102;VC=SNV;GNO;FREQ=KOREAN:0.
NC_000001.11    10008   rs1570391698    A       G       .       .       RS=1570391698;dbSNPBuildID=154;SSR=0;PSEUDOGENEINFO=DDX11L1:100287102;VC=SNV;GNO;FREQ=KOREAN:0.
NC_000001.11    10009   rs1570391702    A       G       .       .       RS=1570391702;dbSNPBuildID=154;SSR=0;PSEUDOGENEINFO=DDX11L1:100287102;VC=SNV;GNO;FREQ=KOREAN:0.
NC_000001.11    10015   rs1570391706    A       G       .       .       RS=1570391706;dbSNPBuildID=154;SSR=0;PSEUDOGENEINFO=DDX11L1:100287102;VC=SNV;GNO;FREQ=KOREAN:0.
NC_000001.11    10019   rs775809821     TA      T       .       .       RS=775809821;dbSNPBuildID=144;SSR=0;PSEUDOGENEINFO=DDX11L1:100287102;VC=INDEL
NC_000001.11    10020   rs1570391708    A       C       .       .       RS=1570391708;dbSNPBuildID=154;SSR=0;PSEUDOGENEINFO=DDX11L1:100287102;VC=SNV;GNO;FREQ=KOREAN:0.
NC_000001.11    10021   rs1570391710    A       G       .       .       RS=1570391710;dbSNPBuildID=154;SSR=0;PSEUDOGENEINFO=DDX11L1:100287102;VC=SNV;GNO;FREQ=KOREAN:0.
NC_000001.11    10026   rs1570391712    A       C       .       .       RS=1570391712;dbSNPBuildID=154;SSR=0;PSEUDOGENEINFO=DDX11L1:100287102;VC=SNV;GNO;FREQ=KOREAN:0.
NC_000001.11    10027   rs1570391716    A       C,G     .       .       RS=1570391716;dbSNPBuildID=154;SSR=0;PSEUDOGENEINFO=DDX11L1:100287102;VC=SNV;GNO;FREQ=KOREAN:0.
NC_000001.11    10032   rs1570391720    A       C       .       .       RS=1570391720;dbSNPBuildID=154;SSR=0;PSEUDOGENEINFO=DDX11L1:100287102;VC=SNV;GNO;FREQ=KOREAN:0.
NC_000001.11    10033   rs1570391722    A       G       .       .       RS=1570391722;dbSNPBuildID=154;SSR=0;PSEUDOGENEINFO=DDX11L1:100287102;VC=SNV;GNO;FREQ=KOREAN:0.
NC_000001.11    10039   rs978760828     A       C       .       .       RS=978760828;dbSNPBuildID=150;SSR=0;PSEUDOGENEINFO=DDX11L1:100287102;VC=SNV;GNO;FREQ=Siberian:0
NC_000001.11    10043   rs1008829651    T       A       .       .       RS=1008829651;dbSNPBuildID=150;SSR=0;PSEUDOGENEINFO=DDX11L1:100287102;VC=SNV;GNO;FREQ=Siberian:
NC_000001.11    10045   rs1570391729    A       C,G     .       .       RS=1570391729;dbSNPBuildID=154;SSR=0;PSEUDOGENEINFO=DDX11L1:100287102;VC=SNV;GNO;FREQ=KOREAN:0.
NC_000001.11    10051   rs1052373574    A       C,G     .       .       RS=1052373574;dbSNPBuildID=150;SSR=0;PSEUDOGENEINFO=DDX11L1:100287102;VC=SNV;GNO;FREQ=KOREAN:0.
NC_000001.11    10051   rs1326880612    A       AC      .       .       RS=1326880612;dbSNPBuildID=151;SSR=0;PSEUDOGENEINFO=DDX11L1:100287102;VC=INDEL
NC_000001.11    10055   rs768019142     T       TA      .       .       RS=768019142;dbSNPBuildID=144;SSR=0;PSEUDOGENEINFO=DDX11L1:100287102;VC=INDEL
NC_000001.11    10055   rs892501864     T       A       .       .       RS=892501864;dbSNPBuildID=150;SSR=0;PSEUDOGENEINFO=DDX11L1:100287102;VC=SNV;GNO;FREQ=Siberian:0
NC_000001.11    10056   rs1570391738    A       C       .       .       RS=1570391738;dbSNPBuildID=154;SSR=0;PSEUDOGENEINFO=DDX11L1:100287102;VC=SNV;GNO;FREQ=KOREAN:0.
NC_000001.11    10057   rs1570391741    A       C,G     .       .       RS=1570391741;dbSNPBuildID=154;SSR=0;PSEUDOGENEINFO=DDX11L1:100287102;VC=SNV;GNO;FREQ=KOREAN:0.
NC_000001.11    10059   rs1570391745    C       G       .       .       RS=1570391745;dbSNPBuildID=154;SSR=0;PSEUDOGENEINFO=DDX11L1:100287102;VC=SNV;GNO;FREQ=KOREAN:0.
NC_000001.11    10063   rs1010989343    A       C,G     .       .       RS=1010989343;dbSNPBuildID=150;SSR=0;PSEUDOGENEINFO=DDX11L1:100287102;VC=SNV;GNO;FREQ=KOREAN:0.
NC_000001.11    10067   rs1489251879    T       TAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCC      .       .       RS=1489251879;dbSNPBuildID=151;SSR=0;PSEUDOGENEINFO=DDX
NC_000001.11    10069   rs1570391755    A       G       .       .       RS=1570391755;dbSNPBuildID=154;SSR=0;PSEUDOGENEINFO=DDX11L1:100287102;VC=SNV;GNO;FREQ=KOREAN:0.
NC_000001.11    10075   rs1570391757    A       G       .       .       RS=1570391757;dbSNPBuildID=154;SSR=0;PSEUDOGENEINFO=DDX11L1:100287102;VC=SNV;GNO;FREQ=KOREAN:0.
NC_000001.11    10077   rs1022805358    C       G       .       .       RS=1022805358;dbSNPBuildID=150;SSR=0;PSEUDOGENEINFO=DDX11L1:100287102;VC=SNV;GNO;FREQ=Siberian:
NC_000001.11    10081   rs1570391762    A       G       .       .       RS=1570391762;dbSNPBuildID=154;SSR=0;PSEUDOGENEINFO=DDX11L1:100287102;VC=SNV;GNO;FREQ=KOREAN:0.
NC_000001.11    10086   rs1570391767    A       C       .       .       RS=1570391767;dbSNPBuildID=154;SSR=0;PSEUDOGENEINFO=DDX11L1:100287102;VC=SNV;GNO;FREQ=KOREAN:0.
NC_000001.11    10092   rs1570391770    A       C       .       .       RS=1570391770;dbSNPBuildID=154;SSR=0;PSEUDOGENEINFO=DDX11L1:100287102;VC=SNV;GNO;FREQ=KOREAN:0.

Output VCF#

The an excerpt of the output of process-dbsnp.sh is shown below, note the contigs are added blind, i.e. this is known from the dbSNP vcf file rather than calculated on the fly.

##fileformat=VCFv4.2
##fileDate=20200501
##source=dbSNP
##dbSNP_BUILD_ID=154
##reference=GRCh38.p12
##phasing=partial
##contig=<ID=1>
##contig=<ID=2>
##contig=<ID=3>
##contig=<ID=4>
##contig=<ID=5>
##contig=<ID=6>
##contig=<ID=7>
##contig=<ID=8>
##contig=<ID=9>
##contig=<ID=10>
##contig=<ID=11>
##contig=<ID=12>
##contig=<ID=13>
##contig=<ID=14>
##contig=<ID=15>
##contig=<ID=16>
##contig=<ID=17>
##contig=<ID=18>
##contig=<ID=19>
##contig=<ID=20>
##contig=<ID=21>
##contig=<ID=22>
##contig=<ID=X>
##contig=<ID=Y>
##contig=<ID=MT>
##INFO=<ID=RS,Number=1,Type=Integer,Description="dbSNP ID (i.e. rs number)">
##INFO=<ID=GENEINFO,Number=1,Type=String,Description="Pairs each of gene symbol:gene id.  The gene symbol and id are delimited by a colon (:) and each pair is delimited by a vertical bar (>
##INFO=<ID=PSEUDOGENEINFO,Number=1,Type=String,Description="Pairs each of pseudogene symbol:gene id.  The pseudogene symbol and id are delimited by a colon (:) and each pair is delimited b>
##INFO=<ID=dbSNPBuildID,Number=1,Type=Integer,Description="First dbSNP Build for RS">
##INFO=<ID=SAO,Number=1,Type=Integer,Description="Variant Allele Origin: 0 - unspecified, 1 - Germline, 2 - Somatic, 3 - Both">
##INFO=<ID=SSR,Number=1,Type=Integer,Description="Variant Suspect Reason Codes (may be more than one value added together) 0 - unspecified, 1 - Paralog, 2 - byEST, 4 - oldAlign, 8 - Para_E>
##INFO=<ID=VC,Number=1,Type=String,Description="Variation Class">
##INFO=<ID=PM,Number=0,Type=Flag,Description="Variant has associated publication">
##INFO=<ID=NSF,Number=0,Type=Flag,Description="Has non-synonymous frameshift A coding region variation where one allele in the set changes all downstream amino acids. FxnClass = 44">
##INFO=<ID=NSM,Number=0,Type=Flag,Description="Has non-synonymous missense A coding region variation where one allele in the set changes protein peptide. FxnClass = 42">
##INFO=<ID=NSN,Number=0,Type=Flag,Description="Has non-synonymous nonsense A coding region variation where one allele in the set changes to STOP codon (TER). FxnClass = 41">
##INFO=<ID=SYN,Number=0,Type=Flag,Description="Has synonymous A coding region variation where one allele in the set does not change the encoded amino acid. FxnCode = 3">
##INFO=<ID=U3,Number=0,Type=Flag,Description="In 3' UTR Location is in an untranslated region (UTR). FxnCode = 53">
##INFO=<ID=U5,Number=0,Type=Flag,Description="In 5' UTR Location is in an untranslated region (UTR). FxnCode = 55">
##INFO=<ID=ASS,Number=0,Type=Flag,Description="In acceptor splice site FxnCode = 73">
##INFO=<ID=DSS,Number=0,Type=Flag,Description="In donor splice-site FxnCode = 75">
##INFO=<ID=INT,Number=0,Type=Flag,Description="In Intron FxnCode = 6">
##INFO=<ID=R3,Number=0,Type=Flag,Description="In 3' gene region FxnCode = 13">
##INFO=<ID=R5,Number=0,Type=Flag,Description="In 5' gene region FxnCode = 15">
##INFO=<ID=GNO,Number=0,Type=Flag,Description="Genotypes available.">
##INFO=<ID=PUB,Number=0,Type=Flag,Description="RefSNP or associated SubSNP is mentioned in a publication">
##INFO=<ID=FREQ,Number=.,Type=String,Description="An ordered list of allele frequencies as reported by various genomic studies, starting with the reference allele followed by alternate all>
##INFO=<ID=COMMON,Number=0,Type=Flag,Description="RS is a common SNP.  A common SNP is one that has at least one 1000Genomes population with a minor allele of frequency >= 1% and for which>
##INFO=<ID=CLNHGVS,Number=.,Type=String,Description="Variant names from HGVS.    The order of these variants corresponds to the order of the info in the other clinical  INFO tags.">
##INFO=<ID=CLNVI,Number=.,Type=String,Description="Variant Identifiers provided and maintained by organizations outside of NCBI, such as OMIM.  Source and id separated by colon (:).  Each >
##INFO=<ID=CLNORIGIN,Number=.,Type=String,Description="Allele Origin. One or more of the following values may be summed: 0 - unknown; 1 - germline; 2 - somatic; 4 - inherited; 8 - paternal>
##INFO=<ID=CLNSIG,Number=.,Type=String,Description="Variant Clinical Significance, 0 - Uncertain significance, 1 - not provided, 2 - Benign, 3 - Likely benign, 4 - Likely pathogenic, 5 - P>
##INFO=<ID=CLNDISDB,Number=.,Type=String,Description="Variant disease database name and ID, separated by colon (:)">
##INFO=<ID=CLNDN,Number=.,Type=String,Description="Preferred ClinVar disease name">
##INFO=<ID=CLNREVSTAT,Number=.,Type=String,Description="ClinVar Review Status: no_assertion - No asserition provided by submitter, no_criteria - No assertion criteria provided by submitter>
##INFO=<ID=CLNACC,Number=.,Type=String,Description="For each allele (comma delimited), this is a pipe-delimited list of the Clinvar RCV phenotype accession.version strings associated with >
#CHROM  POS     ID      REF     ALT     QUAL    FILTER  INFO
1       10001   rs1570391677    T       A       .       .       RS=1570391677;dbSNPBuildID=154;SSR=0;PSEUDOGENEINFO=DDX11L1:100287102;VC=SNV;GNO;FREQ=KOREAN:0.9891,0.0109|SGDP_PRJ:0,1;COMM>
1       10002   rs1570391692    A       C       .       .       RS=1570391692;dbSNPBuildID=154;SSR=0;PSEUDOGENEINFO=DDX11L1:100287102;VC=SNV;GNO;FREQ=KOREAN:0.9944,0.005597
1       10003   rs1570391694    A       C       .       .       RS=1570391694;dbSNPBuildID=154;SSR=0;PSEUDOGENEINFO=DDX11L1:100287102;VC=SNV;GNO;FREQ=KOREAN:0.9902,0.009763
1       10008   rs1570391698    A       G       .       .       RS=1570391698;dbSNPBuildID=154;SSR=0;PSEUDOGENEINFO=DDX11L1:100287102;VC=SNV;GNO;FREQ=KOREAN:0.9969,0.003086
1       10009   rs1570391702    A       G       .       .       RS=1570391702;dbSNPBuildID=154;SSR=0;PSEUDOGENEINFO=DDX11L1:100287102;VC=SNV;GNO;FREQ=KOREAN:0.9911,0.008916
1       10015   rs1570391706    A       G       .       .       RS=1570391706;dbSNPBuildID=154;SSR=0;PSEUDOGENEINFO=DDX11L1:100287102;VC=SNV;GNO;FREQ=KOREAN:0.9942,0.005826
1       10019   rs775809821     TA      T       .       .       RS=775809821;dbSNPBuildID=144;SSR=0;PSEUDOGENEINFO=DDX11L1:100287102;VC=INDEL
1       10020   rs1570391708    A       C       .       .       RS=1570391708;dbSNPBuildID=154;SSR=0;PSEUDOGENEINFO=DDX11L1:100287102;VC=SNV;GNO;FREQ=KOREAN:0.9973,0.002742
1       10021   rs1570391710    A       G       .       .       RS=1570391710;dbSNPBuildID=154;SSR=0;PSEUDOGENEINFO=DDX11L1:100287102;VC=SNV;GNO;FREQ=KOREAN:0.9942,0.005826
1       10026   rs1570391712    A       C       .       .       RS=1570391712;dbSNPBuildID=154;SSR=0;PSEUDOGENEINFO=DDX11L1:100287102;VC=SNV;GNO;FREQ=KOREAN:0.9976,0.002399
1       10027   rs1570391716    A       C,G     .       .       RS=1570391716;dbSNPBuildID=154;SSR=0;PSEUDOGENEINFO=DDX11L1:100287102;VC=SNV;GNO;FREQ=KOREAN:0.9942,0.001371,0.004455
1       10032   rs1570391720    A       C       .       .       RS=1570391720;dbSNPBuildID=154;SSR=0;PSEUDOGENEINFO=DDX11L1:100287102;VC=SNV;GNO;FREQ=KOREAN:0.9966,0.003427
1       10033   rs1570391722    A       G       .       .       RS=1570391722;dbSNPBuildID=154;SSR=0;PSEUDOGENEINFO=DDX11L1:100287102;VC=SNV;GNO;FREQ=KOREAN:0.9949,0.005141
1       10039   rs978760828     A       C       .       .       RS=978760828;dbSNPBuildID=150;SSR=0;PSEUDOGENEINFO=DDX11L1:100287102;VC=SNV;GNO;FREQ=Siberian:0.5,0.5
1       10043   rs1008829651    T       A       .       .       RS=1008829651;dbSNPBuildID=150;SSR=0;PSEUDOGENEINFO=DDX11L1:100287102;VC=SNV;GNO;FREQ=Siberian:0.5,0.5
1       10045   rs1570391729    A       C,G     .       .       RS=1570391729;dbSNPBuildID=154;SSR=0;PSEUDOGENEINFO=DDX11L1:100287102;VC=SNV;GNO;FREQ=KOREAN:0.9897,0.005822,0.004452
1       10051   rs1052373574    A       C,G     .       .       RS=1052373574;dbSNPBuildID=150;SSR=0;PSEUDOGENEINFO=DDX11L1:100287102;VC=SNV;GNO;FREQ=KOREAN:0.9945,0.005479,.|Siberian:0.5,>
1       10051   rs1326880612    A       AC      .       .       RS=1326880612;dbSNPBuildID=151;SSR=0;PSEUDOGENEINFO=DDX11L1:100287102;VC=INDEL
1       10055   rs768019142     T       TA      .       .       RS=768019142;dbSNPBuildID=144;SSR=0;PSEUDOGENEINFO=DDX11L1:100287102;VC=INDEL
1       10055   rs892501864     T       A       .       .       RS=892501864;dbSNPBuildID=150;SSR=0;PSEUDOGENEINFO=DDX11L1:100287102;VC=SNV;GNO;FREQ=Siberian:0.5,0.5
1       10056   rs1570391738    A       C       .       .       RS=1570391738;dbSNPBuildID=154;SSR=0;PSEUDOGENEINFO=DDX11L1:100287102;VC=SNV;GNO;FREQ=KOREAN:0.9945,0.005479
1       10057   rs1570391741    A       C,G     .       .       RS=1570391741;dbSNPBuildID=154;SSR=0;PSEUDOGENEINFO=DDX11L1:100287102;VC=SNV;GNO;FREQ=KOREAN:0.9935,0.006507,.|SGDP_PRJ:0.5,>
1       10059   rs1570391745    C       G       .       .       RS=1570391745;dbSNPBuildID=154;SSR=0;PSEUDOGENEINFO=DDX11L1:100287102;VC=SNV;GNO;FREQ=KOREAN:0.9997,0.0003425
1       10063   rs1010989343    A       C,G     .       .       RS=1010989343;dbSNPBuildID=150;SSR=0;PSEUDOGENEINFO=DDX11L1:100287102;VC=SNV;GNO;FREQ=KOREAN:0.9928,0.004112,0.003084|Siberi>
1       10067   rs1489251879    T       TAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCC      .       .       RS=1489251879;dbSNPBuildID=151;SSR=0;PSEUDOGENEINFO=DDX11L1:100287102;VC=INDEL
1       10069   rs1570391755    A       G       .       .       RS=1570391755;dbSNPBuildID=154;SSR=0;PSEUDOGENEINFO=DDX11L1:100287102;VC=SNV;GNO;FREQ=KOREAN:0.9966,0.003425
1       10075   rs1570391757    A       G       .       .       RS=1570391757;dbSNPBuildID=154;SSR=0;PSEUDOGENEINFO=DDX11L1:100287102;VC=SNV;GNO;FREQ=KOREAN:0.9979,0.002055
1       10077   rs1022805358    C       G       .       .       RS=1022805358;dbSNPBuildID=150;SSR=0;PSEUDOGENEINFO=DDX11L1:100287102;VC=SNV;GNO;FREQ=Siberian:0.5,0.5
1       10081   rs1570391762    A       G       .       .       RS=1570391762;dbSNPBuildID=154;SSR=0;PSEUDOGENEINFO=DDX11L1:100287102;VC=SNV;GNO;FREQ=KOREAN:0.999,0.001027
1       10086   rs1570391767    A       C       .       .       RS=1570391767;dbSNPBuildID=154;SSR=0;PSEUDOGENEINFO=DDX11L1:100287102;VC=SNV;GNO;FREQ=KOREAN:0.9993,0.0006849
1       10092   rs1570391770    A       C       .       .       RS=1570391770;dbSNPBuildID=154;SSR=0;PSEUDOGENEINFO=DDX11L1:100287102;VC=SNV;GNO;FREQ=KOREAN:0.9993,0.0006849

format-alfa#

Reformat the ALFA VCF to regular chromosome names and better sample IDs.

usage: format-alfa [-h] [-v] [-c] infile assembly [outfile]

Positional Arguments#

infile

A required file

assembly

An assembly chromosome mapper

outfile

An optional output file, if not provided output is to STDOUT

Named Arguments#

-v, --verbose

give more output

Default: False

-c, --ignore-chr-version

Ignore the chromosome version i.e. .11

Default: False

In addition to re-mapping the chromosome names, this will also adjust the sample identifiers as detailed in the table below:

ALFA population groups#

ALFA Population ID

Short Description

Remapped ID

Long Description

SAMN10492696

African Others

ALFA_AFO

Individuals with African ancestry

SAMN10492698

African American

ALFA_AFA

African American

SAMN10492703

African

ALFA_AFR

All Africans

SAMN10492695

European

ALFA_EUR

European

SAMN10492699

Latin American 1

ALFA_LAC

Latin American individiuals with Afro-Caribbean ancestry

SAMN10492700

Latin American 2

ALFA_LEN

Latin American individiuals with mostly European and Native American Ancestry

SAMN10492702

South Asian

ALFA_SAS

South Asian

SAMN10492697

East Asian

ALFA_EAS

East Asian (95%)

SAMN10492704

Asian

ALFA_ASN

All Asian individuals (EAS and OAS) excluding South Asian (SAS)

SAMN10492701

Other Asian

ALFA_OAS

Asian individiuals excluding South or East Asian

SAMN11605645

Other

ALFA_OTR

The self-reported population is inconsistent with the GRAF-assigned population

SAMN10492705

Total

ALFA_TOT

Total (~global) across all populations

Input VCF#

Below is an example of the input ALFA VCF:

##fileformat=VCFv4.0
##build_id=20201027095038
##Population=https://www.ncbi.nlm.nih.gov/biosample/?term=GRAF-pop
##FORMAT=<ID=AN,Number=1,Type=Integer,Description="Total allele count for the population, including REF">
##FORMAT=<ID=AC,Number=A,Type=Integer,Description="Allele count for each ALT allele for the population">
#CHROM  POS     ID      REF     ALT     QUAL    FILTER  INFO    FORMAT  SAMN10492695    SAMN10492696    SAMN10492697    SAMN10492698    SAMN10492699    SAMN10492700    SAMN10492701    SAMN1
NC_000001.9     144135212       rs1553120241    G       A       .       .       .       AN:AC   8560:5387       8:8     256:224 336:288 32:24   170:117 32:24   18:13   20:15   344:296 288:2
NC_000001.9     144148243       rs2236566       G       T       .       .       .       AN:AC   5996:510        0:0     0:0     0:0     0:0     0:0     0:0     0:0     84:8    0:0     0:0
NC_000001.9     146267105       rs1553119693    T       G       .       .       .       AN:AC   37168:28800     36:22   56:44   1378:839        18:14   70:60   10:9    4836:3639       452:3
NC_000001.9     148488564       .       C       A       .       .       .       AN:AC   8552:0  8:0     256:0   338:0   32:0    170:0   32:0    16:0    20:0    346:0   288:0   9424:0
NC_000001.10    2701535 rs371068661     C       T       .       .       .       AN:AC   134:9   0:0     0:0     48:1    0:0     0:0     0:0     0:0     188:15  48:1    0:0     370:25
NC_000001.10    2701546 rs587702211     G       A       .       .       .       AN:AC   134:0   0:0     0:0     48:4    0:0     0:0     0:0     0:0     188:2   48:4    0:0     370:6
NC_000001.10    7426777 rs1553119850    GT      G       .       .       .       AN:AC   4473:4462       0:0     0:0     8:0     0:0     0:0     0:0     0:0     24:8    8:0     0:0     4505:
NC_000001.10    7426778 rs1553119849    T       C,G     .       .       .       AN:AC   4494:0,4483     0:0,0   2:0,2   32:0,24 8:0,8   6:0,6   2:0,2   0:0,0   304:0,288       32:0,24 4:0,4
NC_000001.10    12461010        rs762190215     T       TGC,TGCGCGCGC,TGCGCGC   .       .       .       AN:AC   4456:85,8,45    0:0,0,0 0:0,0,0 0:0,0,0 0:0,0,0 0:0,0,0 0:0,0,0 0:0,0,0 8:0,0
NC_000001.11    10001   .       T       C       .       .       .       AN:AC   7618:0  108:0   84:0    2708:0  146:0   610:0   24:0    94:0    470:0   2816:0  108:0   11862:0
NC_000001.11    10007   .       T       C,G     .       .       .       AN:AC   7618:0,0        108:0,0 84:0,0  2708:0,0        146:0,0 610:0,0 24:0,0  94:0,0  470:0,0 2816:0,0        108:0
NC_000001.11    10008   .       A       C,T     .       .       .       AN:AC   7618:0,0        108:0,0 84:0,0  2708:0,0        146:0,0 610:0,0 24:0,0  94:0,0  470:0,0 2816:0,0        108:0
NC_000001.11    10009   .       A       C,G     .       .       .       AN:AC   7616:0,0        108:0,0 84:0,0  2708:0,0        146:0,0 610:0,0 24:0,0  94:0,0  470:0,0 2816:0,0        108:0
NC_000001.11    10013   .       TA      T       .       .       .       AN:AC   6962:0  84:0    84:0    2210:0  146:0   610:0   24:0    94:0    466:0   2294:0  108:0   10680:0
NC_000001.11    10013   .       T       C,G     .       .       .       AN:AC   7618:0,0        108:0,0 84:0,0  2708:0,0        146:0,0 610:0,0 24:0,0  94:0,0  470:0,0 2816:0,0        108:0
NC_000001.11    10014   .       A       C,G,T   .       .       .       AN:AC   7618:0,0,0      108:0,0,0       84:0,0,0        2708:0,0,0      146:0,0,0       610:0,0,0       24:0,0,0
NC_000001.11    10015   .       A       C,G,T   .       .       .       AN:AC   7618:0,0,0      108:0,0,0       84:0,0,0        2708:0,0,0      146:0,0,0       610:0,0,0       24:0,0,0
NC_000001.11    10016   .       C       T       .       .       .       AN:AC   6962:0  84:0    84:0    2210:0  146:0   610:0   24:0    94:0    466:0   2294:0  108:0   10680:0
NC_000001.11    10020   .       A       C,G,T   .       .       .       AN:AC   7616:0,0,0      108:0,0,0       84:0,0,0        2708:0,0,0      146:0,0,0       610:0,0,0       24:0,0,0
NC_000001.11    10021   .       A       C,G     .       .       .       AN:AC   7618:0,0        108:0,0 84:0,0  2708:0,0        146:0,0 610:0,0 24:0,0  94:0,0  470:0,0 2816:0,0        108:0
NC_000001.11    10022   .       C       A,G     .       .       .       AN:AC   7618:0,0        108:0,0 84:0,0  2708:0,0        146:0,0 610:0,0 24:0,0  94:0,0  470:0,0 2816:0,0        108:0
NC_000001.11    10023   .       C       T       .       .       .       AN:AC   6962:0  84:0    84:0    2210:0  146:0   610:0   24:0    94:0    466:0   2294:0  108:0   10680:0
NC_000001.11    10024   .       C       CT      .       .       .       AN:AC   7618:0  108:0   84:0    2708:0  146:0   610:0   24:0    94:0    470:0   2816:0  108:0   11862:0

Output VCF#

Below is an example of the output ALFA VCF, this does nto have the --ignore-chr-version enabled so older assembly chromosomes are removed - NC_000001.9 and NC_000001.10.:

##fileformat=VCFv4.0
##build_id=20201027095038
##Population=https://www.ncbi.nlm.nih.gov/biosample/?term=GRAF-pop
##FORMAT=<ID=AN,Number=1,Type=Integer,Description="Total allele count for the population, including REF">
##FORMAT=<ID=AC,Number=A,Type=Integer,Description="Allele count for each ALT allele for the population">
##contig=<ID=1>
##contig=<ID=2>
##contig=<ID=3>
##contig=<ID=4>
##contig=<ID=5>
##contig=<ID=6>
##contig=<ID=7>
##contig=<ID=8>
##contig=<ID=9>
##contig=<ID=10>
##contig=<ID=11>
##contig=<ID=12>
##contig=<ID=13>
##contig=<ID=14>
##contig=<ID=15>
##contig=<ID=16>
##contig=<ID=17>
##contig=<ID=18>
##contig=<ID=19>
##contig=<ID=20>
##contig=<ID=21>
##contig=<ID=22>
##contig=<ID=X>
##contig=<ID=Y>
##contig=<ID=MT>
#CHROM  POS     ID      REF     ALT     QUAL    FILTER  INFO    FORMAT  ALFA_EUR        ALFA_AFO        ALFA_EAS        ALFA_AFA        ALFA_LAC        ALFA_LEN        ALFA_OAS        ALFA_
1       10001   .       T       C       .       .       .       AN:AC   7618:0  108:0   84:0    2708:0  146:0   610:0   24:0    94:0    470:0   2816:0  108:0   11862:0
1       10007   .       T       C,G     .       .       .       AN:AC   7618:0,0        108:0,0 84:0,0  2708:0,0        146:0,0 610:0,0 24:0,0  94:0,0  470:0,0 2816:0,0        108:0,0 11862
1       10008   .       A       C,T     .       .       .       AN:AC   7618:0,0        108:0,0 84:0,0  2708:0,0        146:0,0 610:0,0 24:0,0  94:0,0  470:0,0 2816:0,0        108:0,0 11862
1       10009   .       A       C,G     .       .       .       AN:AC   7616:0,0        108:0,0 84:0,0  2708:0,0        146:0,0 610:0,0 24:0,0  94:0,0  470:0,0 2816:0,0        108:0,0 11860
1       10013   .       TA      T       .       .       .       AN:AC   6962:0  84:0    84:0    2210:0  146:0   610:0   24:0    94:0    466:0   2294:0  108:0   10680:0
1       10013   .       T       C,G     .       .       .       AN:AC   7618:0,0        108:0,0 84:0,0  2708:0,0        146:0,0 610:0,0 24:0,0  94:0,0  470:0,0 2816:0,0        108:0,0 11862
1       10014   .       A       C,G,T   .       .       .       AN:AC   7618:0,0,0      108:0,0,0       84:0,0,0        2708:0,0,0      146:0,0,0       610:0,0,0       24:0,0,0        94:0,
1       10015   .       A       C,G,T   .       .       .       AN:AC   7618:0,0,0      108:0,0,0       84:0,0,0        2708:0,0,0      146:0,0,0       610:0,0,0       24:0,0,0        94:0,
1       10016   .       C       T       .       .       .       AN:AC   6962:0  84:0    84:0    2210:0  146:0   610:0   24:0    94:0    466:0   2294:0  108:0   10680:0
1       10020   .       A       C,G,T   .       .       .       AN:AC   7616:0,0,0      108:0,0,0       84:0,0,0        2708:0,0,0      146:0,0,0       610:0,0,0       24:0,0,0        94:0,
1       10021   .       A       C,G     .       .       .       AN:AC   7618:0,0        108:0,0 84:0,0  2708:0,0        146:0,0 610:0,0 24:0,0  94:0,0  470:0,0 2816:0,0        108:0,0 11862
1       10022   .       C       A,G     .       .       .       AN:AC   7618:0,0        108:0,0 84:0,0  2708:0,0        146:0,0 610:0,0 24:0,0  94:0,0  470:0,0 2816:0,0        108:0,0 11862
1       10023   .       C       T       .       .       .       AN:AC   6962:0  84:0    84:0    2210:0  146:0   610:0   24:0    94:0    466:0   2294:0  108:0   10680:0
1       10024   .       C       CT      .       .       .       AN:AC   7618:0  108:0   84:0    2708:0  146:0   610:0   24:0    94:0    470:0   2816:0  108:0   11862:0

format-snpstats#

Reformat one or more SNPSTATs files into a VCF format.

usage: format-snpstats [-h] [-o OUTFILE] [--reference-genome REFERENCE_GENOME]
                       [--count-col COUNT_COL] [-v]
                       infiles [infiles ...]

Positional Arguments#

infiles

One or more SNPstats files. Files should not be compressed.

Named Arguments#

-o, --outfile

An optional output file, if not provided output is to STDOUT

--reference-genome

An indexed fasta reference genome, if you want the VCF header to contain all the contigs in the reference genome. If not provided then. chrs 1-22, X, Y, MT are used as a default

--count-col

The name of the allele counts column that will be created in the VCF file

Default: 'ALLELE_COUNT'

-v, --verbose

give more output

Default: False

merge-count-vcfs#

Merge two or more allele count VCF files that have been pre-sorted on chr_name, start_pos). Please do not use for general VCF merging, this

is only for allele count mapping VCF files and should not be mistaken for a generalisable VCF merging script. The VCF files must have 1 or more “AN:AC” fields after format (and nothing else). Where AN, is the total allele number and AC is the count of each alternate allele. The VCF files must be sorted in the same way, which should be the natural string sort order of chromosome name and the numeric sort order of the start position. Also, it is assumed that the VCFs only portray bi-allelic variants. All the variant ID data and INFO fields are taken from the reference VCF file.

Please note that this will perform a system call to tabix, so it should be installed and in your path. Tablix is not used for the merge, only to verify the sort order of all the files being merged.

usage: merge-count-vcfs [-h] [-d DATA_NAMES [DATA_NAMES ...]] [-r REF_NAME]
                        [-g REF_GENOME] [-o OUTFILE] [-T TMP_DIR] [-v]
                        ref_file merge_files [merge_files ...]

Positional Arguments#

ref_file

A vcf to act as a reference file

merge_files

One or more input counts files to merge into ref_file

Named Arguments#

-d, --data-names

One or more dataset names, if not given will default to ds1,ds2,ds3 - if given must equal the numbers of merge files

-r, --ref-name

If you want rows from the reference file labelled in the output then supply a name for the reference

-g, --ref-genome

Path to a reference genome assembly, if provided the contigs from this are used in the output VCF

-o, --outfile

An output file, if provided will be written as a bgzipped file, if not provided then will output to STDOUT

-T, --tmp-dir

An alternate temp location to write to (default /tmp)

-v, --verbose

give more output

Default: False

See merge-count-vcfs.sh for a bash wrapper around this.

merge-cadd#

Merge CADD data into a VCF file.

usage: merge-cadd [-h] [-o OUTFILE] [-T TMP_DIR] [-v]
                  vcf_file cadd_files [cadd_files ...]

Positional Arguments#

vcf_file

A vcf to merge into

cadd_files

One or more input counts files to merge into ref_file

Named Arguments#

-o, --outfile

An output file, if provided will be written as a bgzipped file, if not provided then will output to STDOUT

-T, --tmp-dir

An alternate temp location to write to (default /tmp)

-v, --verbose

give more output

Default: False

split-mapping-file#

Partition the mapping file into a common file and a rare file based on MAF and/or MAC (applied in an OR fashion).

usage: split-mapping-file [-h] [-f MAF] [-c MAC] [-T TMP_DIR] [-v]
                          mapping_file common_out rare_out

Positional Arguments#

mapping_file

A vcf mapping file to partition

common_out

The name of the output file containing the common variants

rare_out

The name of the output file containing the rare variants

Named Arguments#

-f, --maf

The MAF cutoff anything >= to this is common anything < this is rare

Default: 0.01

-c, --mac

The MAC cutoff anything >= to this is common anything < this is rare

Default: 50

-T, --tmp-dir

An alternate temp location to write to

-v, --verbose

give more output

Default: False